Review



antisense oligonucleotide sequences  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Integrated DNA Technologies antisense oligonucleotide sequences
    Antisense Oligonucleotide Sequences, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 654 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotide sequences/product/Integrated DNA Technologies
    Average 94 stars, based on 654 article reviews
    antisense oligonucleotide sequences - by Bioz Stars, 2026-06
    94/100 stars

    Images



    Similar Products

    94
    Integrated DNA Technologies antisense oligonucleotide sequences
    Antisense Oligonucleotide Sequences, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotide sequences/product/Integrated DNA Technologies
    Average 94 stars, based on 1 article reviews
    antisense oligonucleotide sequences - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma oligonucleotides containing the mimic (sense) and inhibitor (antisense) sequences of hsa-mir-186-5p
    Oligonucleotides Containing The Mimic (Sense) And Inhibitor (Antisense) Sequences Of Hsa Mir 186 5p, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides containing the mimic (sense) and inhibitor (antisense) sequences of hsa-mir-186-5p/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    oligonucleotides containing the mimic (sense) and inhibitor (antisense) sequences of hsa-mir-186-5p - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Millipore antisense oligonucleotides (asos) directed against sequences encompassing initiator methionines and polyadenylation sites of candidate mrnas
    Antisense Oligonucleotides (Asos) Directed Against Sequences Encompassing Initiator Methionines And Polyadenylation Sites Of Candidate Mrnas, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides (asos) directed against sequences encompassing initiator methionines and polyadenylation sites of candidate mrnas/product/Millipore
    Average 90 stars, based on 1 article reviews
    antisense oligonucleotides (asos) directed against sequences encompassing initiator methionines and polyadenylation sites of candidate mrnas - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Ribobio co two specific antisense oligonucleotide sequences (asos)
    Two Specific Antisense Oligonucleotide Sequences (Asos), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/two specific antisense oligonucleotide sequences (asos)/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    two specific antisense oligonucleotide sequences (asos) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Ribobio co antisense oligonucleotide sequences (asos)
    Antisense Oligonucleotide Sequences (Asos), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotide sequences (asos)/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    antisense oligonucleotide sequences (asos) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Gene Tools Inc antisense morpholino oligonucleotide (mo) designed to block translation of dync1h1 and consisting of the sequence cgccgctgtcagacatttcctacac
    Antisense Morpholino Oligonucleotide (Mo) Designed To Block Translation Of Dync1h1 And Consisting Of The Sequence Cgccgctgtcagacatttcctacac, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense morpholino oligonucleotide (mo) designed to block translation of dync1h1 and consisting of the sequence cgccgctgtcagacatttcctacac/product/Gene Tools Inc
    Average 90 stars, based on 1 article reviews
    antisense morpholino oligonucleotide (mo) designed to block translation of dync1h1 and consisting of the sequence cgccgctgtcagacatttcctacac - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Qiagen anti-mir124 antisense lna-oligonucleotide sequences
    A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of <t>miR124,</t> a brain-specific miRNA not associated with IGF-1. *: p<0.05.
    Anti Mir124 Antisense Lna Oligonucleotide Sequences, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti-mir124 antisense lna-oligonucleotide sequences/product/Qiagen
    Average 90 stars, based on 1 article reviews
    anti-mir124 antisense lna-oligonucleotide sequences - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Qiagen 1 μm of a dux4 sequence-directed antisense oligonucleotide (aso; ftx-2)
    A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of <t>miR124,</t> a brain-specific miRNA not associated with IGF-1. *: p<0.05.
    1 μm Of A Dux4 Sequence Directed Antisense Oligonucleotide (Aso; Ftx 2), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1 μm of a dux4 sequence-directed antisense oligonucleotide (aso; ftx-2)/product/Qiagen
    Average 90 stars, based on 1 article reviews
    1 μm of a dux4 sequence-directed antisense oligonucleotide (aso; ftx-2) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Millipore antisense biotinylated oligonucleotide sequence (1193-1250) 5’ bio-taactgccga tgggccaatt tttcccttga ttgtagtaag acttgtagcc ttcttacg
    A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of <t>miR124,</t> a brain-specific miRNA not associated with IGF-1. *: p<0.05.
    Antisense Biotinylated Oligonucleotide Sequence (1193 1250) 5’ Bio Taactgccga Tgggccaatt Tttcccttga Ttgtagtaag Acttgtagcc Ttcttacg, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense biotinylated oligonucleotide sequence (1193-1250) 5’ bio-taactgccga tgggccaatt tttcccttga ttgtagtaag acttgtagcc ttcttacg/product/Millipore
    Average 90 stars, based on 1 article reviews
    antisense biotinylated oligonucleotide sequence (1193-1250) 5’ bio-taactgccga tgggccaatt tttcccttga ttgtagtaag acttgtagcc ttcttacg - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Ribobio co antisense oligonucleotides (asos) (sequences in )
    A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of <t>miR124,</t> a brain-specific miRNA not associated with IGF-1. *: p<0.05.
    Antisense Oligonucleotides (Asos) (Sequences In ), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides (asos) (sequences in )/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    antisense oligonucleotides (asos) (sequences in ) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    Image Search Results


    A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of miR124, a brain-specific miRNA not associated with IGF-1. *: p<0.05.

    Journal: PLoS ONE

    Article Title: An Antagomir to MicroRNA Let7f Promotes Neuroprotection in an Ischemic Stroke Model

    doi: 10.1371/journal.pone.0032662

    Figure Lengend Snippet: A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene. Nucleotides (nn) indicate the seed region for each microRNA. B. QPCR analyses of microRNA in the cerebral cortex of adult and middle aged females. Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of miR124, a brain-specific miRNA not associated with IGF-1. *: p<0.05.

    Article Snippet: Four hours post-stroke, animals were administered intracerebroventricular (ICV) injections (ICV; coordinates −1.0 mm anterior posterior, +1.4 mm medial lateral, −3.5 mm relative to the dural surface of either scrambled miR (control), anti-Let 7f, anti-miR1 or an unrelated, anti-miR124 antisense LNA-oligonucleotide sequences, (termed “antagomirs”, Exiqon, Vedbaek, Denmark).

    Techniques: Binding Assay, Expressing

    Female rats were injected with either anti-sense miRNA or scrambled oligonucleotides (control) 4 h after ET-1 induced middle cerebral artery occlusion (MCAo). Infarct volume was assessed using TTC-stained brain sections and quantitative morphometry. A. Animals injected with anti-miR1 had significantly lower cortical infarct volume as compared to controls injected with a scrambled oligo. Striatal infarct was not significantly different between the two groups. B. Animals injected with anti-Let7f had significantly reduced cortical and striatal infarct volumes as compared to controls. C. Animals injected with anti-miR124 had infarct volumes that were similar to the control group. Histograms depict mean ± SEM. *: p<0.05, n = 5 per group.

    Journal: PLoS ONE

    Article Title: An Antagomir to MicroRNA Let7f Promotes Neuroprotection in an Ischemic Stroke Model

    doi: 10.1371/journal.pone.0032662

    Figure Lengend Snippet: Female rats were injected with either anti-sense miRNA or scrambled oligonucleotides (control) 4 h after ET-1 induced middle cerebral artery occlusion (MCAo). Infarct volume was assessed using TTC-stained brain sections and quantitative morphometry. A. Animals injected with anti-miR1 had significantly lower cortical infarct volume as compared to controls injected with a scrambled oligo. Striatal infarct was not significantly different between the two groups. B. Animals injected with anti-Let7f had significantly reduced cortical and striatal infarct volumes as compared to controls. C. Animals injected with anti-miR124 had infarct volumes that were similar to the control group. Histograms depict mean ± SEM. *: p<0.05, n = 5 per group.

    Article Snippet: Four hours post-stroke, animals were administered intracerebroventricular (ICV) injections (ICV; coordinates −1.0 mm anterior posterior, +1.4 mm medial lateral, −3.5 mm relative to the dural surface of either scrambled miR (control), anti-Let 7f, anti-miR1 or an unrelated, anti-miR124 antisense LNA-oligonucleotide sequences, (termed “antagomirs”, Exiqon, Vedbaek, Denmark).

    Techniques: Injection, Staining